Assignments
Work solutiuons/demo code
Important Notes
All Assignments will be submitted via GitHub classroom. Labs and projects will have their own assignment links, all homeworks should be submitted in the homework repository. Follow the instructions below to set that up.
If you did not receive credit (see a 0 on jupiter) for an assignment that you completed, fill out this form. This includes if you submitted work late for an absence or otherwise. _DO NOT__ fill out this form if the assignment doesn’t appear on jupiter at all.
GitHub Classroom Setup Instructions
- Click on the correct link to join the GitHub classroom assignment:
- Period 4: https://classroom.github.com/a/Ue4qdoyn
- After following that link, click “Accept this assignment”
- After ~1 minute (maybe less), refresh the page.
- You should see a link that looks something like: https://github.com/stuycs-gh-classrooms/nextcs-work-jonalf
- The end of that url will differ based on your class period and github username
- Click on that url.
- This will create a GitHub repository for you, and add a basic README.md file to it.
- You will be taken to the repository page for your work. You will see the contents of README.md, which should display: “Work For NeXtCS” and then “Name: YOUR NAME HERE”.
- Edit README.md by clicking on the pencil icon found to the far right of “README.md”
- Replace “YOUR NAME HERE” with your full name, first then last.
- Find the “Commit changes” button and click it.
Git/GitHub Help.
If you need more help with GitHub, look over the following.
-
Lab 07: Living on the Edge!
Due: Monday 5/13 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
Example Output Incorrect
The Example output for the
getNeighborColors()
tests listed in the source code is wrong (it’s based off of a different image). See below for the correct output:0: FFBBAC95 1: FF776C58 2: FFAFA490 3: FFC8B9A2 0: 00000000 1: FF83755B 2: 00000000 3: FFB3A78D 0: FF829E38 1: 00000000 2: FF829E37 3: 00000000
GH Classroom Link: https://classroom.github.com/a/sSx_uxjU
-
Work 23: I'm Flipping Out
Due: Thursday 5/9 10:00am
Submission name: w23_imageFlip
Write a processing program with the follwing features
setup()
- Sets thew screen size.
- Calls
loadImage
to create aPImage
based on an image of your choosing. - calls
loadPixels
on thePImage
variable.
draw()
- Displays the
PImage
using theimage
method.
keyPressed()
- If
r
is pressed:- Reset the
PImage
variable by callingloadImage
- Reset the
- If
h
is pressed:- Set the
PImage
to the return value of thehorizontalFlip
method (defined below).
- Set the
- If
v
is pressed:- Set the
PImage
to the return value of theverticalFlip
method (defined below).
- Set the
- If
m
is pressed:- Set the
PImage
to the return value of themirror
method (defined below).
- Set the
PImage horizontalFlip(PImage pic)
- Return a new
PImage
which will bepic
but flipped horizonally. - This means every column of the new
PImage
should be reveresed from there original values.- i.e. The color at
(0, 0)
should become the color at(width-1, 0)
, the color at(width-1, height-1)
should become the color at(0, height-1)
and so on. - Example:
- i.e. The color at
PImage verticalFlip(PImage pic)
- Return a new
PImage
which will bepic
flipped vertically. - This means every row of the new
PImage
should be reveresed from there original values.- i.e. The color at
(0, 0)
should become the color at(0, height-1)
, the color at(width-1, height-1)
should become the color at(width-1, 0)
and so on. - Example:
- i.e. The color at
PImage mirror(PImage pic)
- Return a new
PImage
which will bepic
split in two parts. - The left sizde (up to
width/2
) should be the same as the original image. - The right side should be the horizontal mirror of the left side.
- i.e. The color at
(0, 0)
should become the color at(0, 0)
, the color at(width/2+1, 0)
should become the color at(width/2, 0)
, the color at(width-1, 0)
should become the color at(0, 0)
, and so on. - Example:
- i.e. The color at
Original image for reference:
-
Work 22: The Colors, Man
Due: Wednesday 5/8 10:00am
Submission name: w22_colorquad
Write a processing program with the follwing features
setup()
- Sets the screen size.
- Calls
loadImage
to create aPImage
based on an image of your choosing. - calls
loadPixels
on thePImage
variable.
draw()
- Displays the
PImage
using theimage
method.
keyPressed()
- If
r
is pressed:- Reset the
PImage
variable by callingloadImage
- Reset the
- If
q
is pressed:- Call the
colorQuad
method (define below). - Call
updatePixels
- Call the
int getIndex(PImage img, int x, int y)
- (
x
,y
) represents the location of a pixel inimg
when thinking of the image as two dimensional. - Returns the corresponding index of pixel (
x
,y
) in the one dimensionalimg.pixels
array. img.width
andimg.height
will return the width adn height ofimg
. (for this funciton you only needimg.width
).
colorQuad(PImage img)
- Modifies the pixels of the
img
object as follows.- All pixles in the upper-left quadrant should have
0
for their blue value. - All pixels in the upper-right quadrant should have
0
for their green value. - All pixels in the lower-left quadrant should have
0
for their red value. - All other color values (including all values in the lower-right) should be the same as the original.
- All pixles in the upper-left quadrant should have
- For this method, it is better to use nested for loops lopping of x and y values to access the pixels. SUe the
getIndex()
function above to find the correct index based on (x, y) values.
-
Lab 06: BST
Due: Wednesday 5/8 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
New Addition Monday 5/6
Change the behavior on right-click to remove the selected value instead of identifying the successor node. Use the following wrapper and recursive method header:
void remove(int v) { root = remove(v, root); setPositions(); //see below for explanation } BSTNode remove(int v, BSTNode current) {
Removal of a node entails:
- first finding the value to be removed from the tree.
- Then finding the successor to that node then:
- If the successor is
null
, the node is a leaf and can be removed. - If the successor is the right child, then that child can be “promoted” up to replace the removed node.
- Otherwise, the successor is a value in the left subtree (though not necessarily the direct left child).
- Replace the current value with the successor node’s value.
- Remove the successor node’s value from the left subtree.
- If the successor is
Sometimes, (when the succor is the right child), we will need to reposition the nodes to see them visually. This is the reason for the
setPositions()
method call in the wrapper method above.Since I want you to focus on the removal part itself, use this for thesetPositions()
warapper and method:void setPositions() { setPositions(root, width/2, 40, 1); } void setPositions(BSTNode current, int x, int y, int level) { if (current != null) { current.position.x = x; current.position.y = y; float xoff = width/pow(2, level+1); y+= Y_SPACE; setPositions(current.left, int(x-xoff), y, level+1); setPositions(current.right, int(x+xoff), y, level+1); } }//setPositions
GH Classroom Link: https://classroom.github.com/a/OLe2OU3Q
-
Work 21: You'll Flip Over This
Due: Thursday 4/18 10:00am
Submission name: w21_flip
For this, you will need the
ExpressionTreeNode
andExpressionTree
classes, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/ExpressionReminder: Test Thursday 4/18
Modify your Expression tree to allow for the following capabilities:
- When an operator node is selected (via mouse press), it changes to another operation. Cycle through the operations like so:
+ - * / + ...
- When a value node is selected, if it is non-zero, change it to zero. If it is zero, change it to an integer in the range [-99, 99]
- When an operator node is selected (via mouse press), it changes to another operation. Cycle through the operations like so:
-
Work 20: Evaluations
Due: Wednesday 4/17 10:00am
Submission name: w20_evaluate
For this, you will need the
ExpressionTreeNode
andExpressionTree
classes, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/ExpressionReminder: Test Thursday 4/18
Expression Tree Nodes:
Modify the class so that when an operation node is displayed, it will show the operation and the value directly underneath the operation. Note: processing’s
text()
function will respect the\n
character.toString()
should not include extra newlines, since that would make traversals less useful.Expression Tree:
- Modify
inOrder()
so that it include()
where appropriate. - Create a new method (and wrapper):
float evaluate(ExpressionTreeNode current)
- If
current
is an operation node, it should evaluate the operation using the left and right subtrees, and setcurrent.value
to that result. - It should always return
current.value
- If
Driver:
Call
showStats()
indraw()
. ModifyshowStats()
so that it evaluates the tree and puts the answer on the left side of the window.
- Modify
-
Work 19: Express Yourself!
Due: Tuesday 4/16 10:00am
Submission name: w19_expression
For this, you will need the
ExpressionTreeNode
andExpressionTree
classes, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/ExpressionReminder: Test Thursday 4/18
Expression Tree Nodes:
Modify the
ExpressionTreeNode
class as follows:- Add a new constructor
ExpressionTreeNode(boolean operation, int x, int y)
- If
operation
istrue
, setvalue
to0
andtype
to a randomint
in the range [1, 4]. - If
operation
isfalse
setvalue
to a random integer in the range [-99, 99] andtype
toVALUE
. - Set the other instance variables as they would be in the other provided constructor.
- If
- Add a
toString()
method which should return aString
containing:- The
value
if the node is a value node. - The correct operation symbol (
+ - * /
) if the node is an operator node.
- The
- Change
display
so that is uses thetoString()
result when printing nodes.
Expression Tree:
Modify
makeTree
in theExpressionTree
class as follows:- Nodes should have a random chance of being operator or value nodes. Use this to determine the randomness:
operator = random(1) < float(levels)/numLevels
- Leaf nodes (nodes at the last possible level of the tree) should always be value nodes, regardless of the random calculation above.
- Value nodes should not have any child nodes.
- Operator nodes should always have 2 child nodes.
- The provided
makeTree
includes the code for position a node, but does not include any recursive parts (base case or recursive case).
- Add a new constructor
-
Lab 05: Balance
Due: Monday 4/15 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
Addition for Friday 4/12
Add the ability to remove nodes with a mouse right-click with the following:
- Tree class
- New wrapper method: void
removeNode(TreeNode target)
- Call
removeNode(target, root)
, do not allowtarget
to be equal toroot
.
- Call
- New recursive method:
void removeNode(TreeNode target, TreeNode current)
- Remove
target
from the tree.current
starts atroot
(see wrapper method above), and traverses untiltarget
can be removed.
- Remove
- New wrapper method: void
- Driver File
mouseButton
is a variable similar tokey
. It will returnLEFT
orRIGHT
depending on which mouse button is being pressed. ModifymousePressed
so thatLEFT
will add a node below the selected node, andRIGHT
will remove the selected node.
GH Classroom Link: https://classroom.github.com/a/na2qHOuD
- Tree class
-
Work 18: Every Node Counts
Due: Thursday 4/11 10:00am
Submission name: w18_treeStats
For this, you will need the
TreeNode
andTree
classes, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/TreeBasicMake the following modifications to your
Tree
class (reminder to keep your base cases tonull
to make your code simpler):- Add wrapper methods for
display()
,preOrder()
,inOrder()
, andpostOrder()
. countNodes(TreeNode current)
- Return the total number of nodes in the tree rooted at
current
. - Also include the wrapper function
countNodes()
- Return the total number of nodes in the tree rooted at
getHeight(TreeNode current)
- Return the height of the tree rooted at
current
. - Remember that the height may not be the same as the value of
numLevels
. - Also include the wrapper function
getHeight()
- Return the height of the tree rooted at
- Display the number of nodes and height in
setup()
- Add wrapper methods for
-
Work 17: Climbing Trees
Due: Tuesday 4/9 10:00am
Submission name: w17_traversal
For this, you will need the
TreeNode
andTree
classes, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/TreeBasicMake the following modifications to your
Tree
class:- Change
makeTree
so that left and right subtrees are not always made.- This means that
makeTree will
no longer definitely make trees with a particular height. That is ok. - You can decided how likely your program is to generate a subtree. If you’re going to use the same percentage each time, I suggest something at least as large as 60%, otherwise you won’t get very interesting trees. If you want to try something fancier, you could tie the percentage to the current level, where levels closer to the root are more likely to have subtrees than lower levels.
- This means that
- Add three methods to the
Tree
class.preOrder
,inOrder
, andpostOrder
. Each should return aString
which is the result of doing a pre, in, and post order traversal of a tree. In your driver file, display the traversal results on the screen.
- Change
-
Work 16: Tree's a Crowd
Due: Monday 4/8 10:00am
Submission name: w16_tree
For this, you will need a
TreeNode
class, which you can get here: https://github.com/nextcs-dw/dwsource/tree/main/NodeStuffCreate a
Tree
class with the following elements:Instance Variables:
TreeNode root
int numLevels
: The height of the tree
Methods:
- Constructor:
Tree(int x, int y, int levels)
- Create a node at (x, y) for the root.
- Set
numLevels
tolevels
- Assign
root.left
androot.right
to the return value formakeTree
(described below).
TreeNede makeTree(int x, int y, int levels)
- Create a new node at
(x, y)
with a random character.char(int(random(26)) + 'A')
- Create a full left subtree with
levels-1
levels - Create a full right subtree with
levels-1
levels - When creating a subtree, you want the next level down to be below and to the left/right of (x, y). You can either make these offsets from (x, y) based on constants (i.e. (x-50, y+100)…) or dynamically based on the current level. You may take either approach.
- If
numLevels
is0
, returnnull
- Create a new node at
void display(TreeNode current)
- Draw the tree rooted at
current
.
- Draw the tree rooted at
Main Driver File. Use the following file:
Tree oak; void setup() { size(800, 500); Oak = new Tree(width/2, 50, 4); oak.display(oak.root); }//setup
-
Lab 04:
Due: Thursday 4/04 10:00am
Submission name: DNAnalysis
Due to some technical difficulties with GitHub, this lab will not a separate GitHub repository. Instead do the following:
- Get the starter code: https://github.com/stuycs-gh-classrooms/nextdw-lab03-dna-template/blob/main/DNAnalysis/DNAnalysis.pde
- Create a new processing program called DNAnalysis.
- Put the DNAnalysis folder in your normal work repository.
-
Work 15: High-Protein Diet
Due: Thursday 3/28 10:00am
Submission name: w15-proteins
Background Genetics Information
DNA is made up of strands of nucleotides, of which there are 4 types: adenine, thymine, cytosine and guanine. Because of this, DNA sequences can be represented as strings like this:
tcgcagctcgaaccactatg
When two strands of DNA match, then adenine is paired with thymine, and cytosine is paired with guanine. So the following two DNA strands match:
tcgcagctcgaaccactatg agcgtcgagcttggtgatac
Generally, DNA is translated into RNA, and then RNA is used to create proteins using amino acids. In DNA, 3 nucleotides together represent a single amino acid. We refer to sequences of 3 nucleotides as codons. Additionally, the sequence atg represents the start of a protein, and taa, tga, and tag represent the end of a protein. We will be working on a processing program to help visualize different information about DNA strands.
Useful Java Stuff
- If you want to look at a working version of the previous assignment, check the solutions github repository.
indexOf(String sub)
is a JavaSting
method that returns either:- The index of the start of the first occurrence of
sub
in the calling string. -1
ifsub
does not appear in the calling string.
- The index of the start of the first occurrence of
substring()
is a JavaString
method that returns a portion of aString
, as a newString
object. There are 2 versions ofsubstring()
:s.substring(start)
- Returns a
String
made from the characters ins
starting at indexstart
and going to the end ofs
.
- Returns a
s.substring(start, end)
- Returns a
String
made from the characters ins
starting at indexstart
and ending at indexend-1
.
- Returns a
Task at Hand
Create a copy of your work from yesterday, then add the following methods:
intFindProteinEnd(String strand)
- Returns the index of the first end codon in
strand
. - Returns
-1
if there is no end codon instrand
.
- Returns the index of the first end codon in
boolean containsProtein(String dna)
- Returns true if
dna
contains at least one full exon. - For our purposes, a DNA sequence contains an exon if:
- It has a start codon
- It has an end codon
- The number of nucleotides between the start and end is a multiple of 3 (i.e. there are no nucleotides unattached to a codon)
- It has at least 5 other codons between those 2. (this is not biologically accurate, in reality this is closer to 430 codons).
- Returns true if
String getProtein(String dna)
- Returns the first protein-encoding (exon) portion of
dna
. It should not include the start or end codons. - If there are no exons in
dna
, return the empyt string.
- Returns the first protein-encoding (exon) portion of
Here are a series of useful test cases for this assignment:
println("protein end in [" + protein1 + "] (21): " + findProteinEnd(protein1)); println("protein end in [" + noProtein0 + "] (-1): " + findProteinEnd(noProtein0)); println("protein end in [" + noProtein2 + "] (3): " + findProteinEnd(noProtein2)); println("protein in [" + protein0 + "] (true): " + containsProtein(protein0)); println("protein in [" + protein1 + "] (true): " + containsProtein(protein1)); println("protein in [" + protein2 + "] (true): " + containsProtein(protein2)); println("protein in [" + noProtein0 + "] (false): " + containsProtein(noProtein0)); println("protein in [" + noProtein1 + "] (false): " + containsProtein(noProtein1)); println("protein in [" + noProtein2 + "] (false): " + containsProtein(noProtein2)); println("protein in [" + noProtein3 + "] (false): " + containsProtein(noProtein3)); println("protein in [" + noProtein4 + "] (false): " + containsProtein(noProtein4)); println(); println("protein in [" + protein0 + "] " + getProtein(protein0));
-
Work 14: The Code of Life
Due: Wednesday 3/27 10:00am
Submission name: w14_drawDNA
Background Genetics Information
DNA is made up of strands of nucleotides, of which there are 4 types: adenine, thymine, cytosine and guanine. Because of this, DNA sequences can be represented as strings like this:
tcgcagctcgaaccactatg
When two strands of DNA match, then adenine is paired with thymine, and cytosine is paired with guanine. So the following two DNA strands match:
tcgcagctcgaaccactatg agcgtcgagcttggtgatac
Task at Hand
Using the information above, write the following processing functions:
void drawBase(char base, int x, int y, int sz)
- Draws a single base in a square at
(x, y)
with side lengthsz
. - The squares should have no stroke, and each type of nucleotide should be given a distinct color.
- The letter for the nucleotide should be displayed within the square in a color that is easy to see.
- Draws a single base in a square at
void drawStrand(String dna, int x, int y, int sz)
- Draws the entire
dna
strand starting at(x, y)
usingsz
for the size of each square. - This method should call
drawBase()
.
- Draws the entire
boolean strandMatch(String strand0, String strand1)
- Returns
true
ifstrand0
andstrand1
match as described above.
- Returns
void strandCompare(String strand0, String strand1, int x, int y, int sz)
- Draws
strand0
directly abovestrand1
. - If there is a nucleotide mismatch, draw a red border around the nucleotide.
- Draws
- Write a
setup()
method that tests these methods.
-
Work 13: What a Bunch of Characters
Due: Thursday 3/21 10:00am
Submission name: w13_drawChar
Write a processing program with the following functions
color charToColor(char c)
- Create and return a
color
based on the value ofc
as follows: - Multiply c by 23, 41 and 67, respectively to to get red, green and blue values (you could use other numbers, but small, relatively prime numbers work best).
- Don’t forget to make sure each color is within the range
[0, 255]
void drawChar(char c, int x, int y)
- Draw a square using the color from
charToColor()
at the givenx
andy
location, usingc
as the side length. - Set
textSize
to the value ofc
. - Display
c
as a character inside the square.
setup()
- Set the screen size to 600x400
- Using a
for
loop controlled by achar
variable, loop through the chars from'A'
to'Z'
, callingdrawChar()
appropriately. Setx
andy
values as you see fit.
Reference Image:
- Create and return a
-
Project 00: May The Force(s) Be With You
Due: Multiple Due Dates
Submission name: New GH Classroom link
- GH Classroom link: https://classroom.github.com/a/OlxVcITS
Project Description
Your mission is to
destroy the Death Starcreate a Processing program that demonstrates different physical forces, building off of the framework we have been creating in class. Your program should do the following:- Reasonably model gravity (in the classical mechanics sense), drag, and the spring force. The force calculations for both have already been done in class.
- Add one more force. The force can be rooted in reality, or something of your own invention. Regardless, calculating the force should involve some combination of an orbs mass, velocity, acceleration and external factors (which may be another orb). Calculating the force should work the same way as the others, by adding a method that returns a
PVector
to theOrb
class. - Add the ability to toggle on/off the wall bouncing behavior (which has been built in to all our physics programs from the start).
- Use both an array and a linked list amongst different simulations.
- Produce different simulations as follows:
- A demonstration of gravity showing “planets” orbiting a central massive body. This one should use an array of orbs with a fixed central orb.
- A demonstration of the spring force that includes at least 1 non moving orb. This should use a linked list of orbs.
- A demonstration of drag that involves at least 2 or more orbs moving through at least 2 areas with different drag results.
- A demonstration that combines at least 3 of the forces.
Interface Requirements
Your program should be able to visually indicate:
- Whether movement is on/off
- Whether bouncing is on/off
- Which force(s) are currently being applied. Your program should respond to the following keyboard commands:
' '
: movement on/off'b'
: wall bouncing on/off'1'
: Setup simulation 1 (orbital gravity)'2'
: Setup simulation 2 (spring)'3'
: Setup simulation 3 (drag)'3'
: Setup simulation 4 (custom)'3'
: Setup simulation 5 (combination)
Phase 0 - Analyze & Plan
Due: Monday, 3/18 10:00am
Fill in the README.md file created when you make your repository.
Phase 1 - Demos & Feedback
Due: Tuesday, 3/26 10:00am
In class on Monday, you should have a program that performs at least 3 of your proposed simulations. During class, other students will have a chance to run your code and provide feedback, so it is important that your project is in a state where it can work. More details on the logistics of theses demos will be published Tuesday.
Phase 2 - Finished Version & Documentations
Due: Tuesday, 4/2 10:00am
Instructions to follow By this time your repository should have the final version of your program. You will also need to complete a document describing your project use this template to create a file in your repository called FINAL.md.
Your completed repository should have the following parts:
- README.md: Your design document.
- FINAL.md: Your project summary document (described above).
- Processing Program Folder
- Make sure all of your code files have the .pde extension are in a folder with the same name as your driver file (i.e. a normal processing program folder.).
-
Lab 03: Node Springs
Due: Friday 3/15 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
GH Classroom Link: https://classroom.github.com/a/z4DmpFE-
-
Work 12: Noddeing Off
Due: Wednesday 3/13 10:00am
Submission name: w12_orbnodes
We will continue with the work started in class on using a node based
Orb
structure.-
Start with the program developed in class.
-
Add the following to the driver file (it should still do all the things from the previous assignment).
- The ability to calculate and apply earthGravity if that option is on.
- The ability to add a random node to the front of the chain when
'='
is pressed. - The ability to remove the front node of the chain when
'-'
is pressed. - For adding and removing, you may assume there is always at least 1 node.
-
-
Work 11: Nodular Design
Due: Tuesday 3/12 10:00am
Submission name: w11_orbnodes
We will continue with the work started in class on using a node based
Orb
structure.-
Start with the program developed in class.
OrbNode
should also have the following methodsvoid display(int springLength)
- Display the
OrbNode
. - If there is a
next
node, draw a line betweenthis
and thenext
OrbNode
objects. - Make the color of the line related to the state of the spring (extended, compressed, neither).
- Display the
void applySprings(int springLength, float springK)
- Apply the spring force between the calling Orb and it’s
next
andprevious
neighbors when applicable.
- Apply the spring force between the calling Orb and it’s
- Write a driver file that creates at least 3
OrbNodes
and connects them. Then indraw
- Use a
while
loop to display eachOrbNode
- Use a
while
loop to callapplySprings
on eachOrbNode
- Use a
while
loop to callrun
on eachOrbNode
- These loops should not be integer-counter based.
- Use a
Reference Image:
-
-
Lab 02: Spring Ahead!
Due: Monday 3/11 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
GH Classroom Link: https://classroom.github.com/a/hkaiVBFE
ADDITION FRIDAY!!!
Once you have the lab working, add the following features:
- When the
-
key is pressed, the lastOrb
in the array should be removed.- This action does not need to change the size of the
Orb
array. - This should not change the functionality of the rest of the program.
- If the
Orb
array is empty, there should be no action (otherwise you’ll get aNullPointerException
).
- This action does not need to change the size of the
- When the
=
key is pressed, a newOrb
should be added at the end of the chain ofOrbs
.- This may or may not require you to “expand” the
Orb
array. (arrayCopy
(link)) can assist you here. - Be careful, as the end of the chain of the orbs may not be the last spot in the
Orb
array.
- This may or may not require you to “expand” the
- When the
-
Work 10: Spring into Action
Due: Thursday 3/7 10:00am
Submission name: w10_spring
Add Spring
Add the method
PVector getSpring(Orb o, int springLength, float springConstnat)
- This should calculate the force of a spring between the calling object and
o
. - The resulting force should pull the calling object towards
o
if the spring is extended pastspringLength
and should push the calling object away fromo
if the spring is compressed to be less thanspringLength
.
Create a driver file that tests the spring force. A single
FixedOrb
and regularOrb
will suffice.Relevant Physics to find the force a spring connecting \(A\) to \(B\), where \(B\) is a fixed point:
- \[F = kx\hat{AB}\]
- Where \(k\) is the spring constant,
- \(x\) is the displacement, or difference of the distance between \(A\) and \(B\) and the length of the spring.
- \(\hat{AB}\) is the normalized vector from \(A\) to \(B\).
- This should calculate the force of a spring between the calling object and
-
Work 09: Massive Changes
Due: Tuesday 3/5 10:00am
Submission name: w09_mass
Add Drag
Start with the code from class today (source code page will be updated by the end of class). BEfore doing anything, it should have a collection of
Orb
objects exerting a gravitational force on each other. Currently the “mass” of ourOrb
objects is tied to thesize
. We will separate those two by adding afloat mass
field to theOrb
class. You will need the following changes:- Add
float mass
as a field toOrb
. - Modify the parameter based constructor to take a
float
parameter for themass
. - Modify the default constructor to set the
mass
to a random value in the range [10, 100). - Modify the color so that it scales with the density (mass/size) of the
Orb
. The most dense orbs should be black and the least dense should be whatever original color you set (in my example this is (0, 255, 255)). You should look at thelerpColor
(link) function in processing to help.
Reference Image:
- Add
-
Work 08: What a Drag
Due: Wednesday 2/28 10:00am
Submission name: w08_drag
Calculate Drag
Drag is a force that “pushes” opposite to velocity. In order to calculate the drag force we need to figure out the direction it will apply and the magnitude of the force. The (simplified) Formula for Drag is:
\[{\overrightarrow F} = -\dfrac{1}{2} v^2 C_d {\hat v}\]What is this?
- \(v\) Is the magnitude of the velocity vector. Luckily, we can get the magnitude using
velocity.mag()
, which returns afloat
value. - \(C_d\) is the coefficient of drag, this is different depending on the material (air, water, honey…).
- \({\hat v}\) is the normalized velocity vector. This has the same direction as the velocity vector, but the magnitude is 1. Once again, we have a nice method for this.
vector.normalize()
will normalize a vector (it will modifyvector
, so don’t do this directly onvelocity
).
Add Drag
Start with the work from yesterday (but make a new sketch and submission). Add drag to your simulation as follows:
- Add
PVector getDragForce(float coef)
to theOrb
class. It should calculate and return aPVector
representing drag as described above. draw()
- When an
Orb
reaches a height of200
or more, calculate and apply a drag force. - Draw a rectangle from (0, 200) that takes up the lower half of the screen to help see when the drag force should be applied.
- When an
Reference Image:
- \(v\) Is the magnitude of the velocity vector. Luckily, we can get the magnitude using
-
Work 07: That's Not How the Force Works
Due: Wednesday 2/28 10:00am
Submission name: w07_forcerunner
Use the Force
Start with the code developed in class. You will modify the driver file to produce a more complex simulation as follows:
- Create an array of
Orb
objects. - Create two forces as
PVector
objects,gravity
andwind
. - Add a
boolean
variablemoving
that will control whether the simulation is runnogn or not. setup()
- Make the
gravity
andwind
forces <0, 0>. - Create at least 5
Orb
objets. They should all have the same y coordiante, x values that keep them from overlapping and random sizes in the range [10, 60).
- Make the
draw()
- Display all the
Orb
objects in the array. - Display the current values of the
gravity
andwind
forces. - If
moving
istrue
, applygravity
andwind
to all theOrb
objects, then callrun()
on each.
- Display all the
keyPressed()
- Left/Right arrows: Change the x direction of
wind
in 0.1 incriments. - Up/Down arrows: Change the y direction of
gravity
in 0.1 incriments. - Space: Toggle
moving
on/off.
- Left/Right arrows: Change the x direction of
Reference Image:
- Create an array of
-
Lab 01: Fill Up Your Tanks
Due: Friday 2/16 10:00am
Submission name: New GH Classroom Link
Over the next few days we’ll be expanding our Aquarium programs. Start by creating a new repository with the link below and following the instructions in the README.md file.
GH Classroom Link: https://classroom.github.com/a/oq20sLQj
Full Assignment Guidelines
For this lab, you will have a driver file,
Tank
class,Animal
subclass and at least 4 subclasses ofAnimal
. Guidelines below:- Driver file
- When the program is run, initialize and empty
Tank
. - In
draw()
display theTank
and have it call whatever method you’ve created that will run the simulation. - Users should be able to add new
Animal
subclass objects to the tank with the number keys1-0
, each key should map to a different subclass. TheAnimal
should be placed at the current coordinates of the mouse.
- When the program is run, initialize and empty
Animal
class general requirements- All animals should be able to be displayed on the screen.
- All animals should be able to move about the tank.
- NEW all animals should have some way to die. Options discussed in class are:
- Needing a certain amount of food, with food being added somehow in the driver (possible mouse click).
- Needing a certain amount of food, but the food comes from eating other (smaller) animals.
- A combination of both of theses, or something else.
- Subclasses
- Each subclass should differ at a minimum by:
- How they look.
- How they move.
- At least one subclass should have a different death mechanism from the other three.
Tank
class- Have defined water and floor areas.
- Hold all the animals in an
ArrayList<Animal>
instance variable. - Have a method that displays all the animals.
- Have a method that runs the simulation, which may include movement and eating/death in one, or may be split up into multiple methods.
- Each subclass should differ at a minimum by:
- Driver file
-
Work 06: Something Seems Fishy
Due: Monday 2/12 10:00am
Submission name: w06_fish
Make some Fish! (or other animal)
Create two subclasses of
Animal
and add them to your program. At a minimum, your subclasses must have different movement behavior and look different. You made add other changes if you have time. One subclass should be an animal that stays in the water area of the tank, the other should stay on the ground area of the tank.Using Images (not required!)
If you want to use small images as the displayed shapes for your subclasses, you can look into the
PImage
processing class. Specifically theloadimage
andimage
functions. In order to use images, you must put them in a directory calleddata/
inside your processing sketch folder. Here is a small example that loads and displays and image:PImage img; img = loadImage("shells.jpg"); image(img, 0, 0, 25, 50); //the image's corner will be at (0, 0) and the size of the image will be 25x50
-
Work 05:
Due: Friday 2/8 10:00am
Submission name: w05_aquarium
Overview
Over the next few days, we will create an aquarium program. In this program we will have an
Tank
class, which will contain various subclasses ofAnimal
. When the program is run, we will see the aquarium, and all of the animals in it moving about.Design Requirements
Tank
class:- Should have a well defined “floor” area visually distinct from the water.
- Does not necessarily have to take up the entire screen.
- Should have the ability to store many
Animal
objects.
Animal
class:- You wrote an outline of what an
Animal
should have yesterday, add the features you believe are necessary, be sure to include the following: - All animals should be able to move within the tank.
- An animal should never move outside the tank.
- Eventually, we will have subclasses of
Animal
, but to start, consider what common instance variables and methods would be needed. - Remember, since the
Tank
class will only know that it hasAnimal
objects, it will only be able to use methods from theAnimal
class.
There may be other elements to the aquarium as well.
Build it!
Write the
Tank
andAnimal
classes that at a minimum meet the requirements stated above. You can use the small driver file below, which adds an animal when the mouse is pressed. We will add more to this over the next few days.Tank t; int tankX = 0; int tankY = 50; int floorH = 100; int tankW; int tankH; void setup() { size(600, 600); tankW = width; tankH = height - 50; t = new Tank(tankX, tankY, tankW, tankH, floorH); t.display(); }//setup void draw() { background(150); t.moveAnimals(); t.display(); } void mouseClicked() { t.addAnimal(mouseX, mouseY); }
-
Work 04: Kingdom Anamalia
Due: Thursday 2/7 10:00am
Submission name: w04_aquarium-design.md
Overview
Over the next few days, we will create an aquarium program. In this program we will have an
Tank
class, which will contain various subclasses ofAnimal
(and possibly others). When the program is run, we will see the aquarium, and all of the animals in it moving about.Class Design
In class, we discussed lots of things that can go into our aquarium. Let’s start designing it, focussing on the Animals inside. In a markdown document, including the following:
- A class hierarchy showing the
Animal
superclass and the subclasses of it. You may represent this tree using text only, or by draying it and including an image (to add an image to a markdown document:![image description](path to image)
, e.g.![a cat](cat.jpg)
just make sure you upload the image as well. - A list of the instance variables and methods you believe should go into the
Animal
superclass.
- A class hierarchy showing the
-
Lab 00: So Many Shapes
Due: Wednesday 2/07 10:00am
Submission name: New GH Classroom Link
Read the instructions in the code and write the requested code.
GH Classroom Link: https://classroom.github.com/a/9a_tYj9W
-
Work 03: Finding Your Center
Due: Monday 2/6 10:00am
Submission name: w03_centroid
A Little Geomerty:
The centroid of a polygon is a formulaic way of identifying what we would consider the “center”, which is non-trivial for irregular polygons. To find the centroid you must iterate over all the vertices of the polygon.
- For each point from 0 to the number of points - 1, take the sum of the following, stored separately (like in
sumX
andsumY
variables):- \[(x_{i} + x_{i+1})(x_{i}y_{i+1} - x_{i+1}y_{i})\]
- \[(y_{i} + y_{i+1})(x_{i}y_{i+1} - x_{i+1}y_{i})\]
- When
i
gets to the last point, perform the calculations above replacing \(i + 1\) with0
. That is to say the correct calculation requires the last point to loop back around to the first.
- Take each of those sums and divide them by
6
times the signed area of the polygon.
Add Centroid to our Shapes
With all this in mind, add the following features to the
PathShape
class from last week:- 1 new instance variables:
PVector centroid
: an array to store thex
andy
values of the centroid.
- 1 new method
void setCentroid()
- Sets the
centroid
instance variable.
- Sets the
- 2 modified methods
display
- Draws a circle of diameter 5 at the centroid. Use a different color than the
inside
instance variable.
- Draws a circle of diameter 5 at the centroid. Use a different color than the
makeRandomShape()
or the Constructor- call
setCentroid()
aftersetArea()
- call
- For each point from 0 to the number of points - 1, take the sum of the following, stored separately (like in
-
Work 02: Area, but Harder
Due: Monday 2/5 10:00am
Submission name: w02_inherit
A Little Geomerty:
The signed area of a polygon is a measure of how much space is enclosed by the shape. For a polygon with non intersecting sides, this is the same as the area, but it is also a measure that can be made for shapes with sides that intersect.
- The signed area can be found by iterating over the vertices of the polygon. For each point from 0 to the number of points - 1, take the sum of the following (this is known as the shoelace formula).
sum+=
\((x_{i} y_{i+1} - x_{i+1}y_{i})\)- When
i
gets to the last point, perform the calculations above replacing \(i + 1\) with0
. That is to say the correct calculation requires the last point to loop back around to the first. - At then end, take the cumulative sum and divide it by 2, this is the signed area.
Add Area to our Shapes
First, get the updated
PathShapeDriver
code from the source code page (this includes updates from class on Friday). Then add the following:- To
PathShape
- New instance variables:
float area
: stores the signed area.
- New method:
void setArea()
- Sets the
area
instance variable as defined above.
- Sets the
- Modified method:
void makeRandomShape()
- Call
setArea()
after the points are made. - Set
inside
to magenta (255, 0, 255) ifarea
is less thanshapeSize
and cyan (0, 255, 255) isarea
is greater thanshapeSize
.
- Call
- Verify that the above changes have been added to
Polygon
, if not, add code toPolygon
where needed.
- The signed area can be found by iterating over the vertices of the polygon. For each point from 0 to the number of points - 1, take the sum of the following (this is known as the shoelace formula).
-
Work 00: Shaping Your Path
Due: Thursday 2/1 10:00am
Submission name: w00_pathShape
Step 0: Create your new work repository:
Use this link: https://classroom.github.com/a/Ue4qdoyn
Step 1: Code!
Create a class called
PathShape
. APathShape
will represent a shape made by connecting a series of points that will be contained in a square area (but may not take up the entire area).A
PathShape
will have the following instance variables:ArrayList<PVector> points
; An ArrayList ofPVector
objects representing the vertices of the PathShape.- You can see more about PVectors here but at the moment, we only need to use the fact that they have
x
andy
instance variables.
- You can see more about PVectors here but at the moment, we only need to use the fact that they have
int numPoints
: The total number of vertices the shape should have.PVector corner
: (x, y) position of thew top-left area that will contain the shape.- int ShapeSize: The side length of the suqare area that will contain the shape.
color inside
: The fill color for the shape.
And the following methods:
PathShape(int np, int cx, int cy, int ss)
:- Set
numPoints
to np. - Sets the corner to (cx, cy).
- Sets
shapeSize
toss
. - Sets
inside
to a color of your chosing. - Initializes
points
and callsmakeRandomShape()
(see below).
- Set
void makeRandomShape()
- Adds
np
random points topoints
by callingmakeRandomPoint()
- The shape need not be a polygon.
- Adds
PVector makeRandomPoint()
- Returns a new
PVector
object where the x and y values will always be within the square area that defines the callingPathShape
object.
- Returns a new
display()
- Use beginShape,
vertex
andendshape
to draw thePathShape
on the processing screen. - The shape use the instance variable colors accordingly.
- The shape should be closed, so that last point should connect to the first.
- Use beginShape,
Create a drive file that will create 4 PathShape objects to be displayed in a grid like so:
-
Work 00: Getting to Know You
Due: Monday 09/11 10:00am
- Please fill out the student info form found here: https://forms.gle/xkZ9kjw2kEjd6MuWA
- You will need a GitHub account in order to submit work for this class. If you don’t have one already, go to https://github.com/ and create one.
- If you attach it to your stuy.edu email address, you can sign up for the GitHub Student Developer Pack. It includes access to a bunch of programming tools/services. It is not required that you sign up for it.
- Read and acknowledge the Stuyvesant Computer Science Lab and Network Usage Policy
- Download & install Processing.
- Make sure to install version 4.3 for your appropriate operating system (OS).